pentr d topo (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
95
Structured Review
New England Biolabs
pentr d topo
Pentr D Topo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 443 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+d+topo/Topoisomerase+I/bio_rxiv__2025__10__01__679805-42-19-21
Average 95 stars, based on 443 article reviews
Pentr D Topo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 443 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pentr+d+topo/Topoisomerase+I/bio_rxiv__2025__10__01__679805-42-19-21
Average 95 stars, based on 443 article reviews
pentr d topo - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Amplification:Article Title: HNF1A is a novel BRD4 target and critical for BET-inhibitor response in pancreatic ductal adenocarcinoma Article Snippet: .. Human MYC was amplified from AsPC-1 cDNA with primers 5’-AGGCTCCGCGGCCGCCCCCTTCACCATGCCCCTCAACGTTAGCTTCACC - 3’ and 5’-TGGGTCGGCGCGCCCACCCTTTTACGCACAAGAGTTCCGTAGCTG - 3’ and cloned into Article Title: Targeting FGFR4 abrogates HNF1A-driven metastasis in pancreatic ductal adenocarcinoma Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAGGCTCCGCGGCCGCCCCCTTCACCATGCGGCTGCTGCTGGCCCTGTTGG-3’ and 5’-TGGGTCGGCGCGCCCACCCTTTCATGTCTGCACCCCAGACCCGAAGG-3’, digested with SacII and Ascl, and cloned into Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin remodeling Article Snippet: .. At myosin XI-2-ΔGTD, consisting of amino acid residues 1–1047, which is described as Heavy meromyosin (HMM) by , were generated by PCR amplification from the full-length sequence and subcloned into Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin Remodeling. Article Snippet: Plant myosin XI plays a crucial role in intracellular transport, known as cytoplasmic streaming.. Previous studies have identified associations between myosin XI and organelles by using a cargo-binding tail domain that lacks a motor domain.. However, the subcellular localization and dynamics of full-length myosin XI remain poorly understood. Article Title: Targeting FGFR4 abrogates HNF1A-driven metastasis in pancreatic ductal adenocarcinoma. Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAG GCT CCG CGG CCG CCC CCT TCA CCA TGC GGC TGC TGC TGG CCC TGT TGG-3’ and 5’-TGG GTC GGC GCG CCC ACC CTT TCA TGT CTG CAC CCC AGA CCC GAAGG-3’, digested with SacII and Ascl, and cloned into Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAGGCTCCGCGGCCGCCCCCTTCACCATGCGGCTGCTGCTGGCCCTGTTGG-3’ and 5’-TGGGTCGGCGCGCCCACCCTTTCATGTCTGCACCCCAGACCCGAAGG-3’, digested with SacII and Ascl, and cloned into Clone Assay:Article Title: HNF1A is a novel BRD4 target and critical for BET-inhibitor response in pancreatic ductal adenocarcinoma Article Snippet: .. Human MYC was amplified from AsPC-1 cDNA with primers 5’-AGGCTCCGCGGCCGCCCCCTTCACCATGCCCCTCAACGTTAGCTTCACC - 3’ and 5’-TGGGTCGGCGCGCCCACCCTTTTACGCACAAGAGTTCCGTAGCTG - 3’ and cloned into Article Title: Targeting FGFR4 abrogates HNF1A-driven metastasis in pancreatic ductal adenocarcinoma Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAGGCTCCGCGGCCGCCCCCTTCACCATGCGGCTGCTGCTGGCCCTGTTGG-3’ and 5’-TGGGTCGGCGCGCCCACCCTTTCATGTCTGCACCCCAGACCCGAAGG-3’, digested with SacII and Ascl, and cloned into Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. For labeling cells with firefly luciferase, PatGFP (a variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V) was fused to the N-terminus of firefly luciferase Luc2 (Promega) (subcloned from pGL4.10) and cloned into Article Title: Two genetically linked Arabidopsis TIR-type NLRs are required for immunity and interact with NLRs encoded in a segmentally duplicated genomic region Article Snippet: The full-length genomic sequences (with or without promoter region) were PCR amplified without stop codon, using gene specific primers listed in , and cloned into pENTR/D-TOPO (ThermoFisher Scientific, https://www.thermofisher.com ) Gateway entry vectors. .. The generation of truncations, or site-directed mutagenesis, was conducted by sub-cloning into Article Title: Targeting FGFR4 abrogates HNF1A-driven metastasis in pancreatic ductal adenocarcinoma. Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAG GCT CCG CGG CCG CCC CCT TCA CCA TGC GGC TGC TGC TGG CCC TGT TGG-3’ and 5’-TGG GTC GGC GCG CCC ACC CTT TCA TGT CTG CAC CCC AGA CCC GAAGG-3’, digested with SacII and Ascl, and cloned into Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAGGCTCCGCGGCCGCCCCCTTCACCATGCGGCTGCTGCTGGCCCTGTTGG-3’ and 5’-TGGGTCGGCGCGCCCACCCTTTCATGTCTGCACCCCAGACCCGAAGG-3’, digested with SacII and Ascl, and cloned into Labeling:Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. For labeling cells with firefly luciferase, PatGFP (a variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V) was fused to the N-terminus of firefly luciferase Luc2 (Promega) (subcloned from pGL4.10) and cloned into Luciferase:Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. For labeling cells with firefly luciferase, PatGFP (a variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V) was fused to the N-terminus of firefly luciferase Luc2 (Promega) (subcloned from pGL4.10) and cloned into Variant Assay:Article Title: Targeting FGFR4 Abrogates HNF1A-driven Metastasis in Pancreatic Ductal Adenocarcinoma Article Snippet: .. For labeling cells with firefly luciferase, PatGFP (a variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V) was fused to the N-terminus of firefly luciferase Luc2 (Promega) (subcloned from pGL4.10) and cloned into Generated:Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin remodeling Article Snippet: .. At myosin XI-2-ΔGTD, consisting of amino acid residues 1–1047, which is described as Heavy meromyosin (HMM) by , were generated by PCR amplification from the full-length sequence and subcloned into Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin Remodeling. Article Snippet: Plant myosin XI plays a crucial role in intracellular transport, known as cytoplasmic streaming.. Previous studies have identified associations between myosin XI and organelles by using a cargo-binding tail domain that lacks a motor domain.. However, the subcellular localization and dynamics of full-length myosin XI remain poorly understood. Polymerase Chain Reaction:Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin remodeling Article Snippet: .. At myosin XI-2-ΔGTD, consisting of amino acid residues 1–1047, which is described as Heavy meromyosin (HMM) by , were generated by PCR amplification from the full-length sequence and subcloned into Article Title: Two genetically linked Arabidopsis TIR-type NLRs are required for immunity and interact with NLRs encoded in a segmentally duplicated genomic region Article Snippet: The full-length genomic sequences (with or without promoter region) were PCR amplified without stop codon, using gene specific primers listed in , and cloned into pENTR/D-TOPO (ThermoFisher Scientific, https://www.thermofisher.com ) Gateway entry vectors. .. The generation of truncations, or site-directed mutagenesis, was conducted by sub-cloning into Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin Remodeling. Article Snippet: Plant myosin XI plays a crucial role in intracellular transport, known as cytoplasmic streaming.. Previous studies have identified associations between myosin XI and organelles by using a cargo-binding tail domain that lacks a motor domain.. However, the subcellular localization and dynamics of full-length myosin XI remain poorly understood. Sequencing:Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin remodeling Article Snippet: .. At myosin XI-2-ΔGTD, consisting of amino acid residues 1–1047, which is described as Heavy meromyosin (HMM) by , were generated by PCR amplification from the full-length sequence and subcloned into Article Title: Dynamics of full-length Arabidopsis myosin XI and its involvement in actin Remodeling. Article Snippet: Plant myosin XI plays a crucial role in intracellular transport, known as cytoplasmic streaming.. Previous studies have identified associations between myosin XI and organelles by using a cargo-binding tail domain that lacks a motor domain.. However, the subcellular localization and dynamics of full-length myosin XI remain poorly understood. Mutagenesis:Article Title: Two genetically linked Arabidopsis TIR-type NLRs are required for immunity and interact with NLRs encoded in a segmentally duplicated genomic region Article Snippet: The full-length genomic sequences (with or without promoter region) were PCR amplified without stop codon, using gene specific primers listed in , and cloned into pENTR/D-TOPO (ThermoFisher Scientific, https://www.thermofisher.com ) Gateway entry vectors. .. The generation of truncations, or site-directed mutagenesis, was conducted by sub-cloning into Countercurrent Chromatography:Article Title: Targeting FGFR4 abrogates HNF1A-driven metastasis in pancreatic ductal adenocarcinoma. Article Snippet: .. Human FGFR4 was amplified from UM5 cDNA with primers 5’-CAG GCT CCG CGG CCG CCC CCT TCA CCA TGC GGC TGC TGC TGG CCC TGT TGG-3’ and 5’-TGG GTC GGC GCG CCC ACC CTT TCA TGT CTG CAC CCC AGA CCC GAAGG-3’, digested with SacII and Ascl, and cloned into |